Journal: Frontiers in Immunology

Article Title: Ultraviolet B Inhibits IL-17A/TNF-α-Stimulated Activation of Human Dermal Fibroblasts by Decreasing the Expression of IL-17RA and IL-17RC on Fibroblasts

doi: 10.3389/fimmu.2017.00091

Figure Lengend Snippet: Primers for the target genes in real-time quantitative PCR .

Article Snippet: Detection of IL-17RA and IL-17RC expression were performed using human IL-17RA-FITC and IL-17RC-FITC antibodies (Miltenyi Biotec, Bergisch Gladbach, Germany).

Techniques: Real-time Polymerase Chain Reaction

Journal: Frontiers in Immunology

Article Title: Ultraviolet B Inhibits IL-17A/TNF-α-Stimulated Activation of Human Dermal Fibroblasts by Decreasing the Expression of IL-17RA and IL-17RC on Fibroblasts

doi: 10.3389/fimmu.2017.00091

Figure Lengend Snippet: Real-time quantitative PCR analyses of HDFs stimulated with IL-17A (100 ng/ml) and TNF-α (10 ng/ml) alone or together for 24 h. The results demonstrate that both IL-17A and TNF-α induce significant increases in IL-6, IL-8, and CXCL-1 mRNA expression and IL-17A/TNF-α stimulation have additive or synergistic effect on IL-6, IL-8, and CXCL-1 mRNA expression . Additionally, IL-17A induces the mRNA expression of TNFR-2 and TNF-α induces IL-17RA and IL-17RC expression on HDFs. The data (fold change) are from one representative experiment performed in triplicate, repeated three times with similar results. HDFs, human dermal fibroblasts. Statistical significance indicated: * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: Detection of IL-17RA and IL-17RC expression were performed using human IL-17RA-FITC and IL-17RC-FITC antibodies (Miltenyi Biotec, Bergisch Gladbach, Germany).

Techniques: Real-time Polymerase Chain Reaction, Expressing

Journal: Frontiers in Immunology

Article Title: Ultraviolet B Inhibits IL-17A/TNF-α-Stimulated Activation of Human Dermal Fibroblasts by Decreasing the Expression of IL-17RA and IL-17RC on Fibroblasts

doi: 10.3389/fimmu.2017.00091

Figure Lengend Snippet: Real-time quantitative PCR analyses of HDFs treated with IL-17A (100 ng/ml)/TNF-α (10 ng/ml), UVB (30 mJ/cm 2 ), and TGF-β1 (2 ng/ml) for 24 h . (A) IL-17A/TNF-α-stimulated HDFs increase expression of IL-6, IL-8, and CXCL-1 mRNA, which are also seen in 30 mJ/cm 2 UVB-irradiated HDFs. But UVB irradiation inhibits IL-17A/TNF-α-induced IL-6, IL-8, and CXCL-1 mRNA expression of HDFs. IL-17A/TNF-α stimulation induce the expression of TNFR-2, IL-17RA, and IL-17RC mRNA. UVB irradiation upregulates the expression of TNFR-1 and TNFR-2 mRNA but downregulates IL-17RA and IL-17RC expression, and inhibits IL-17A/TNF-α-induced IL-17RA and IL-17RC mRNA expression. IL-17A/TNF-α and UVB treatment do not induce significant expression of TGF-β1 mRNA 24 h after culture, but Smad3 mRNA is upregulated in both UVB irradiation and IL-17A/TNF-α + UVB groups. (B) TGF-β1 significantly induces the Smad3 mRNA expression and downregulates the IL-17RA and IL-17RC expression in HDFs. The data (fold change) are from one representative experiment performed in triplicate, repeated three times with similar results. UVB, ultraviolet B; HDFs, human dermal fibroblasts. Statistical significance indicated: * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: Detection of IL-17RA and IL-17RC expression were performed using human IL-17RA-FITC and IL-17RC-FITC antibodies (Miltenyi Biotec, Bergisch Gladbach, Germany).

Techniques: Real-time Polymerase Chain Reaction, Expressing, Irradiation

Journal: Frontiers in Immunology

Article Title: Ultraviolet B Inhibits IL-17A/TNF-α-Stimulated Activation of Human Dermal Fibroblasts by Decreasing the Expression of IL-17RA and IL-17RC on Fibroblasts

doi: 10.3389/fimmu.2017.00091

Figure Lengend Snippet: Protein detection by using Western blot, ELISA analysis, and flow cytometry . (A) Western blot of HDFs lysates confirms mRNA expression of IL-6, IL-8, and CXCL-1 at the protein level, although shows no significant increase in IL-8 protein of UVB group compared with Control group and no significant decrease in IL-6 and CXCL-1 protein of IL-17A/TNF-α + UVB group compared with IL-17A/TNF-α group. (B) ELISA analysis of the supernatant confirms mRNA expression of IL-6, IL-8, and CXCL-1 at the protein level. (C) The expression of IL-17RA and IL-17RC mRNA is confirmed by flow cytometry for detection of the surface expression of IL-17RA and IL-17RC on HDFs. The data (fold change) of Western blot are expressed as the mean ± SD of three independent experiments. Other data are from one representative experiment performed in triplicate, repeated three times with similar results. UVB, ultraviolet B; HDFs, human dermal fibroblasts. Statistical significance indicated: * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: Detection of IL-17RA and IL-17RC expression were performed using human IL-17RA-FITC and IL-17RC-FITC antibodies (Miltenyi Biotec, Bergisch Gladbach, Germany).

Techniques: Western Blot, Enzyme-linked Immunosorbent Assay, Flow Cytometry, Expressing, Control

Journal: Frontiers in Immunology

Article Title: Ultraviolet B Inhibits IL-17A/TNF-α-Stimulated Activation of Human Dermal Fibroblasts by Decreasing the Expression of IL-17RA and IL-17RC on Fibroblasts

doi: 10.3389/fimmu.2017.00091

Figure Lengend Snippet: Protein detection by using ELISA analysis, Western blot, and flow cytometry . (A) ELISA analysis shows significant TGF-β1 protein secretion in supernatant in both UVB and IL-17A/TNF-α + UVB groups. (B) Western blot shows the protein expression of Smad3 is significantly upregulated in both UVB and IL-17A/TNF-α + UVB groups. (C) Flow cytometry shows P144 (2 µg/ml) is able to block the inhibitory effect of UVB on the expression of IL-17RA and IL-17RC on HDFs. The data (fold change) of Western blot are expressed as the mean ± SD of three independent experiments. Other data are from one representative experiment performed in triplicate, repeated three times with similar results. UVB, ultraviolet B; HDFs, human dermal fibroblasts. Statistical significance indicated: * P < 0.05, ** P < 0.01.

Article Snippet: Detection of IL-17RA and IL-17RC expression were performed using human IL-17RA-FITC and IL-17RC-FITC antibodies (Miltenyi Biotec, Bergisch Gladbach, Germany).

Techniques: Enzyme-linked Immunosorbent Assay, Western Blot, Flow Cytometry, Expressing, Blocking Assay

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f ), IL-1β + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Immunohistochemical staining, Staining, Immunofluorescence, Double Staining, Marker

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Studies on anti-cytokine treatments in experimental and human stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Injection, Functional Assay, Recombinant, Plasmid Preparation, Clinical Proteomics, Infection

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Mechanistic profile of cytokine and cytokine receptor agonists/antagonists for use in experimental stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Bioprocessing, Dominant Negative Mutation, Recombinant

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Temporal profile of cytokine and cytokine receptor upregulation in the acute phase after pMCAO. a Graphical presentation of the temporal profile of TNF, LTα, TNFR1, and TNFR2 mRNAs in the same ischemic hemispheres from mice subjected to pMCAO. b Graphical presentation of the temporal profile of IL-1β, IL-1α, IL-1Ra, IL-1R1, and IL-1R2 mRNAs after pMCAO. c Graphical presentation of the temporal profile of IL-6, IL-6R, and gp130 mRNAs after pMCAO. Data are presented as relative increases in mRNA levels compared with unmanipulated controls. TNF, TNFR1 and TNFR2 mRNA data have been obtained from [ , ], whereas LTα mRNA data are unpublished data performed on the same experimental mice and conditions as . The sequence of the LTα TaqMan probe was AGGAGGGAGTTGTTGCTCAAAGAGAAGCCA, for the LTα sense primer it was CTGCTGCTCACCTTGTTGGG, and for the LTα antisense primer it was TAGAGGCCACTGGTGGGGAT. IL-1α, IL-1β, IL-1Ra, IL-1R1, and IL-1R2 mRNA data have been obtained from . IL-6, IL-6R, and gp130 mRNA data have been obtained from . Note the logarithmic Y axis. gp130 glycoprotein 130, IL interleukin, IL-6R interleukin-6 receptor, LT α lymphotoxin-alpha, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Sequencing

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Schematics presenting mechanisms of actions of approved and selected experimental cytokine and cytokine receptor agonists and antagonists. a – c TNF ( a ), IL-1 ( b ), and IL-6 ( c ) signaling via their receptors and mechanisms of actions of approved and selected novel inhibitors. Figures are modified using Protein Lounge Pathway Database ( www.proteinlounge.com ). Ab antibody, gp130 glycoprotein 130, icIL-1Ra intracellular interleukin-1 receptor antagonist, IL interleukin, IL-1Ra interleukin-1 receptor antagonist, IL-1R1 interleukin-1 receptor type 1, IL-1R2 interleukin-1 receptor type 2, IL-1RAcP IL-1 receptor accessory protein, sIL-1RAcP soluble IL-1 receptor accessory protein, IL-6R interleukin-6 receptor, sgp130 soluble glycoprotein 130, solIL-6R soluble interleukin-6 receptor, solTNF soluble tumor necrosis factor, tmTNF transmembrane tumor necrosis factor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Modification

Journal: The Journal of Biological Chemistry

Article Title: Human CD300C Delivers an Fc Receptor-?-dependent Activating Signal in Mast Cells and Monocytes and Differs from CD300A in Ligand Recognition *

doi: 10.1074/jbc.M112.434746

Figure Lengend Snippet: Cell surface expression of CD300A and CD300C in human hematopoietic cells. A, analysis of CD300A or CD300C expression in hematopoietic cells derived from human PB. FSChighSSChigh populations in neutrophils or eosinophils or FSClow/intSSClow/int populations in basophils, T cells, B cells, monocytes, NK cells, or PDCs were gated. The cells were stained with FITC-conjugated anti-CD3, CD19, CD56, BDCA-2, CD123, or CD16 mAb or allophycocyanin-conjugated anti-CD14 mAb and analyzed for CD300A or CD300C expression. B, human PB-derived Mφ-1 or Mφ-2 were stained with R-PE-conjugated anti-CD11b, CD14, or HLR-DR mAb or FITC-conjugated CD11c mAb and were analyzed for CD300A or CD300C expression. C, human monocyte-derived DCs were cultured for 24 h in the presence or absence of 1 ng/ml LPS or 10 ng/ml TNFα. The cells were stained with R-PE-conjugated anti-CD80, CD83, or CD86 mAb and were analyzed for CD300A or CD300C expression. D, human PB-derived mast cells were analyzed for CD300A or CD300C expression. The results of control staining are shown as filled histograms. All of the data are representative of three independent experiments.

Article Snippet: R-PE-conjugated anti-human blood dendritic cell antigen-2 mAb and FITC-conjugated CD16 or CD123 mAb were from Miltenyi Biotech.

Techniques: Expressing, Derivative Assay, Staining, Cell Culture, Control

Journal: iScience

Article Title: DUSP6 deletion protects mice and reduces disease severity in autoimmune arthritis

doi: 10.1016/j.isci.2024.110158

Figure Lengend Snippet:

Article Snippet: anti-CD25-APC (clone: 4E3) , Miltenyi Biotec, Germany , Cat# 130-113-846.

Techniques: Transgenic Assay, Knock-Out

Journal: Frontiers in Immunology

Article Title: Grass pollen allergoids conjugated with mannan for subcutaneous and sublingual immunotherapy: a dose-finding study

doi: 10.3389/fimmu.2024.1431351

Figure Lengend Snippet: Variations (fold-change) in circulating Treg cells and grass allergen-specific IL-10-producing cells after four months of treatment depending on dose and route of administration (subcutaneous: left panels; sublingual: right panels) (A) Percentage of Treg cells (CD4 + CD127 - CD25 + FOXP3 + ) relative to total CD4 + T cells. (B) Number of Phleum-specific spot-forming cells (SFC) secreting IL-10 after their expansion in vitro . (C) Data as in panel B but regrouping of subjects as indicated. Results are expressed as fold-change (median; interquartile range) relative to baseline. Comparison with placebo, Unpaired T test or Mann-Whitney test: * p<0.05.

Article Snippet: For Treg cell analysis, PBMC were first subjected to surface staining with anti-human CD4-PerCP, CD127-PE, and CD25-APC (Miltenyi Biotec).

Techniques: In Vitro, Comparison, MANN-WHITNEY